---name: crispr-design-agent description: A specialized tool for designing efficient and specific gRNA sequences for CRISPR-Cas9 experiments. license: MIT metadata: author: AI Group version: "1.0.0" compatibility:
- system: Python 3.10+ allowed-tools:
- run_shell_command
- read_file
keywords:
- crispr-design-agent
- automation
- biomedical measurable_outcome: execute task with >95% success rate. ---"
CRISPR Design Agent
The CRISPR Design Agent automates the selection of guide RNAs (gRNAs) for gene editing. It scans DNA sequences for PAM sites, extracts spacers, and scores them based on efficiency rules (GC content, homopolymers).
When to Use This Skill
- When designing a CRISPR knockout or knock-in experiment.
- To find all valid Cas9 target sites in a given DNA sequence.
- To filter gRNAs by efficiency scores.
Core Capabilities
- Target Discovery: Identifies NGG PAM sites.
- Efficiency Scoring: Calculates scores based on GC content and sequence features.
- Filtering: Sorts guides by predicted efficacy.
Workflow
- Input: Provide a DNA sequence (raw string or FASTA file) and target gene name.
- Process: The agent scans the sequence and applies scoring logic.
- Output: Returns a ranked list of gRNA sequences with coordinates and scores.
Example Usage
User: "Find gRNAs for this sequence: ATCG..."
Agent Action:
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
--sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
--output guides.json